Hasil Pencarian  ::  Simpan CSV :: Kembali

"Toksoplasmosis adalah penyakit yang disebabkan oleh Toxoplasma gondii, penyakit tersebut menyebabkan kelainan kongenital seperti hidrosefalus, katarak, retinitis, retardasi mental, abortus dan pada penderita imunodefisiensi gejala menjadi lebih berat. Karena itu pelt' dilakukan diagnosis dini, supaya dapat di beri pengobatan secepatnya.Penelitian ini bertujuan untuk mengetahui apakah teknik PCR dapat mendeteksi DNA genom Toxoplasma gondii. Teknik ini dilakukan terhadap DNA genom takizoit T gondii, dengan menggunakan primer 5' GGA ACT GCA TCC GTT CAT GAG 3' dan 5' TCT TTA AAG CGT TCG TGG TC 3', dan dilakukan standarisasi terhadap konsentrasi MgCI2 (1.5 dan 2.0 mM), konsentrasi enzim taq polimerase (0.7 unit dan 1.75 unit), konsentrasi DNA cetakan 50, 5, 1, 0.5, 0.1, 0.05, 0.01, 0.005, dan 0.001 ng, dan jumlah siklus (35 siklus dan 55 siklus).Hasil menunjukkan bahwa konsentrasi MgCI2 (1.5 mM), 1.75 unit taq polimerase, konsentrasi DNA cetakan 50, 5, 1, 0.5, 0.1, 0.05, 0.01, 0.005, dan 0.001 ng, dan jumlah siklus 55 memberikan hasil produk PCR berupa pita berukuran 193 pb.Berdasarkan hasil ini dapat disimpulkan bahwa teknik PCR sangat sensitif, yaltu dapat mendeteksi 1 pg DNA Toxoplasma gondii (1 takizoit)."

"Toxopiasnia Gondii adalah suatu protozoa yang dapat menginfeksi manusia. Infeksi T.gondii pada orang dewasa biasanva tanpa gejala klinis, sedangkan pada orang yang imunokompromais dapat berakibat fatal. Diagnosis toksoplasinosis biasanya dilakukan dengan uji serologi yaitu enzyrnelinked inunurnosorbent assay (ELISA) untuk mendeteksi IgG dan IgM Namun pemeriksaan serologi ini tidak memberikan hasil yang memuaskan, sedangkan pengobatan dini perlu dilakukan. Polymerase chain reaction (PCR) merupakan salah satu teknik yang dapat mengatasi masalah tersebut. Penetitian bertujuan untuk mengetahui apakah teknik PCR dapat mendeteksi DNA T.gondii dengan optimasi tekniknya. Teknik ini dilakukan terhadap DNA takizoit T.gondii dengan menggunakan primer 5'GGAACTGCATCCGTTCATGAG3' dan 5'TCITTAAAGCGTTCGTGGTC3'. konsentrasi MgC12 1,5 mM dan 2,0 mM, konsentrasi enzim taq polimerase 0,7 U dan 1,75 U, konsentrasi cetakan DNA 50; 5; 1; 0,5; 0,1; 0,05; 0,01; 0,005 dan 0,001 ng dan jumlah siklus : 35 dan 55 siklus. Hasil menunjukkan bahwa konsentrasi MgC12 1,5 mM, konsentrasi taq polimerase 1,75 U dengan jumlah siklus 55 inemberikan hasil produk PCR berupa pita berukuran 193 hp dengan konsentrasi cetakan DNA sampai 0,00 ng. Dapat disimpulkan bahwa teknik PCR merupakan teknik yang sensitif yaitu dapat mendeteksi 1 pg DNA gondii.

---

Polymerase Chain Reaction to Detect Tachyzoites of Toxoplasma gondiiToxoplasma gondii is a protozoan which can infect human. T. gondii infection is oiler asymptomatic in healthy individuals, however in imrnunocompromised individuals it can be fatal. Diagnosis of toxoplasmosis is usually performed by serology using enzyme-linked immunosorbent assay (ELISA) to detect IgG and IgM. However, serology tests do not give an adequate result, while early treatment is necessarily performed. Polymerase chain reaction is a technique which can solve the problem.

The aim of this study is to know whether the PCR technique can detect ".gondii DNA. The technique was performed on DNA of T .gondii tachyzoites using Bl gene primers : 5' GGAACTGCATCCGITCATGAG3' and 5'TCTTTAAAGCGTTCGTG G T C with MgCI2 concentrations of 1.5 mM and 2.0 mM, taq polymerase concentrations of 0.7 U and 1.75U, with DNA template concentations of 50, 5, 1, 0.5. U.1, 0.05, 0.01, 0.005 and 0.001 n.. Cycles used in this study were 35 and 55.

The results showed that concentrations of 1.5 mM MgC12 and 1.75 U taq polymerase using 55 cycles gave good PCR results. With electrophoresis, the PCR product was a band of 193 bp.

It was concluded that PCR is a sensitive technique which can detect 1 pg of T .gondii DNA."

"[Transmisi infeksi protozoa usus dapat diminimalisir melalui memperhatikan pola hidup bersih dengan baik. Pola hidup bersih terdiri dari status sanitasi dasar, kebersihan pribadi, dan kebersihan konsumsi. Penelitian ini dilakukan untuk mengamati hubungan antara pola hidup bersih dan temuan protozoa usus dengan menggunakan desain penelitian potong lintang. Pengambilan data dilakukan pada Juli 2014 terhadap 94 penduduk dewasa sebagai subyek penelitian di DKI Jakarta dan TPA Bantar Gebang. Subyek penelitian dibagi menjadi dua kelompok, status pola hidup bersih yang baik dan pola hidup bersih yang tidak baik. Hasil penelitian didapatkan pada 53 subyek dengan status sanitasi dasar yang baik ditemukan hanya 41,5% temuan protozoa usus positif. Pada 70 subyek dengan kebersihan pribadi yang baik, hanya 48,6% temuan protozoa usus positif. Pada 56 subyek dengan kebersihan konsumsi yang baik, hanya 39,3% temuan protozoa usus positif. Pada penelitian ini, didapatkan p:0,035; 0,409;0,006, berurutan.Rasio prevalensi pada kebersihan konsumsi yang didapatkan yakni 3 (IK 95% 1,4-7,9)., Transmission of the intestinal protozoan infection can be minimized by focusing on hygienic lifestyle. Hygienic lifestyle consists of basic hygiene, personal hygiene, and food hygiene. This research was made to observe the correlation between hygiene lifestyle and the finding of intestinal protozoan, using cross sectional design. The data collection was held in July 2014 to the 94 adult people as the research subjects in Jakarta and Bantar Gebang landfill. The research subjects were divided into two groups, good hygienic lifestyle and poor hygienic lifestyle. Result of this research was known that 53 subjects as good basic hygienic, positive finding of intestinal protozoan was only 41,5%. In 70 subjects as good personal hygiene, positive finding of intestinal protozoan was only 48,6%. In 56 subjects as good food hygiene, positive finding of intestinal protozoan was only 39,3%. In this research, p: 0,035; 0,409; 0,006, respectively. Prevalence ratio of food hygiene was 3 (CI 95% 1,4-7,9).]"

"[ABSTRAKLatar belakang. Kolitis infeksi adalah proses inflamasi pada usus besar yang disebabkan oleh infeksi bakteri patogen, seperti Shigella, Salmonella, E.coli, dan Campylobacter. Dibuktikan dengan pemeriksaan kultur tinja, tetapi biayanya cukup mahal, perlu waktu dan tidak selalu tersedia di semua fasilitas kesehatan. Rekomendasi WHO jumlah lekosit lebih dari 10 per LPB untuk Shigella disentriae dengan klinis disentri dan merupakan indikasi pemberian antibiotika. Sering ditemukan anak diare dengan lekosit kurang dari 10/LPB tetapi hasil kultur positif bakteri patogen. Mencari hubungan jumlah lekosit tinja dengan kejadian diare yang disebabkan infeksi bakteri patogen yang memerlukan terapi antibiotika.Tujuan. Mengetahui prevalensi, sebaran bakteri patogen, nilai leukosit mikroskopik tinja pada anak dengan kolitis infeksi bakteri. Mengetahui hubungan leukosit tinja dengan kultur tinja dan pola sensitivitas antibiotika pada kolitis infeksi bakteri.Metode. Penelitian deskriptif dengan metode potong lintang dan uji diagnostik untuk menilai sensitivitas hitung leukosit tinja untuk mendiagnosis kolitis infeksi bakteri. Penelitian dilakukan di Rumah Sakit Umum Pusat Rujukan Nasional Cipto Mangunkusumo, Jakarta, dari bulan Januari- Juni 2015.Hasil. Dari 45 subjek penelitian ditemukan kultur positif pada 19 subjek (42,2%). Bakteri terbanyak yang ditemukan adalah E.coli (79%), Salmonella sp. (10,5%), dan C.difficille (10,5%). Pada titik potong ROC ditemukan nilai lekosit >8 per LPB dengan sensitivitas 0,654 dan spesifisitas 0.632. E.coli masih memperlihatkan sensitivitas cukup tinggi terhadap kloramfenikol dan siprofloksasin tetapi tidak terhadap sefiksim. Salmonella sp. sensitif terhadap kloramfenikol, sefiksim, dan seftriakson, sedangkan C. difficile sensitif terhadap Seftriakson.Simpulan. Pada penelitian ini ditemukan sebanyak 19 (42,2%) subyek penderita diare hasil kultur tinja positif bakteri patogen dan pada titik potong ROC ditemukan nilai lekosit > 8 per LPB dengan sensitivitas 65.4% dan spesifisitas 63.2%. Pada pola sensitivitas antibiotika, E.coli sensitif terhadap kloramfenikol dan siprofloksasin dan Salmonella dan C.difficile sensitif terhadap seftriakson.

---

ABSTRACTBackground. Infective colitis is an inflammatory process in the colon caused by pathogenic bacterial infection, such as Shigella, Salmonella, E.coli, and Campylobacter. Diagnosis is made by fecal culture, but the cost is relatively expensive, time-consuming, and not readily available in every health facility. WHO recommends that fecal leukocyte more than 10 per HPF for the diagnosis of Shigella disentriae with clinical symptom of dysentriae and indicated for antibiotic treatment. Often there are diarrheic children with leukocyte less than 10/HPF but the culture is positive for pathogenic bacteria. This study would like to look for the relationship between fecal leukocyte and incidence of diarrhea caused by pathogenic bacteria infection that requires antibiotic therapy.Objective. To study the prevalence, distribution of pathogenic bacteria, leukocyte count in fecal microscopic test in children with bacterial infective colitis. To study the relationship between fecal leukocyte and fecal culture with sensitivity pattern of antibiotics in bacterial infective colitis.Methods. Descriptive, cross-sectional study and diagnostic test to study the sensitivity of fecal leukocyte count in diagnosing bacterial infective colitis. Study was performed in the Cipto Mangunkusumo Hospital, Jakarta, from January to June 2015.Results. From 45 study subjects, positive culture was found in 19 subjects (42.2%), and the most common bacteria were E.coli (79%), Salmonella sp. (10.5%), and C. difficille (10,5%). At the ROC we found leukocyte count >8 per HPF as cutoff point with 0.654 sensitivity and 0.632 specificity. E. coli still showed relatively high sensitivity to chloramphenicol and ciprofloxacin, but not to cefixime. Salmonella sp. were sensitive to chloramphenicol, cefixime, and ceftriaxone, while C. difficile were sensitive to ceftriaxone.Conclusion. In this study there were 19 (42.2%) subjects with diarrhea, with positive fecal culture for pathogenic bacteria. At the ROC cutoff point we found leukocyte count > 8 per HPF with 65.4% sensitivity and 63.2% specificity. On the antibiotic sensitivity pattern, E. coli was sensitive to chloramphenicol and ciprofloxacin, while Salmonella dan C.difficile were sensitive to ceftriaxone, Background. Infective colitis is an inflammatory process in the colon caused by pathogenic bacterial infection, such as Shigella, Salmonella, E.coli, and Campylobacter. Diagnosis is made by fecal culture, but the cost is relatively expensive, time-consuming, and not readily available in every health facility. WHO recommends that fecal leukocyte more than 10 per HPF for the diagnosis of Shigella disentriae with clinical symptom of dysentriae and indicated for antibiotic treatment. Often there are diarrheic children with leukocyte less than 10/HPF but the culture is positive for pathogenic bacteria. This study would like to look for the relationship between fecal leukocyte and incidence of diarrhea caused by pathogenic bacteria infection that requires antibiotic therapy.Objective. To study the prevalence, distribution of pathogenic bacteria, leukocyte count in fecal microscopic test in children with bacterial infective colitis. To study the relationship between fecal leukocyte and fecal culture with sensitivity pattern of antibiotics in bacterial infective colitis.Methods. Descriptive, cross-sectional study and diagnostic test to study the sensitivity of fecal leukocyte count in diagnosing bacterial infective colitis. Study was performed in the Cipto Mangunkusumo Hospital, Jakarta, from January to June 2015.Results. From 45 study subjects, positive culture was found in 19 subjects (42.2%), and the most common bacteria were E.coli (79%), Salmonella sp. (10.5%), and C. difficille (10,5%). At the ROC we found leukocyte count >8 per HPF as cutoff point with 0.654 sensitivity and 0.632 specificity. E. coli still showed relatively high sensitivity to chloramphenicol and ciprofloxacin, but not to cefixime. Salmonella sp. were sensitive to chloramphenicol, cefixime, and ceftriaxone, while C. difficile were sensitive to ceftriaxone.Conclusion. In this study there were 19 (42.2%) subjects with diarrhea, with positive fecal culture for pathogenic bacteria. At the ROC cutoff point we found leukocyte count > 8 per HPF with 65.4% sensitivity and 63.2% specificity. On the antibiotic sensitivity pattern, E. coli was sensitive to chloramphenicol and ciprofloxacin, while Salmonella dan C.difficile were sensitive to ceftriaxone]"

"[Penicillium marneffei merupakan fungi patogen yang ditemukan di AsiaTenggara, khususnya Thailand. Penisiliosis dapat menyebabkan mikosis sistemiksehingga membahayakan nyawa penderita immunocompromised, khususnyapenderita HIV/AIDS. Antifungi seperti Fluconazole dan Ketoconazole, digunakanuntuk mengatasi infeksi P. marneffei. Akan tetapi, penggunaan antifungi secarajangka panjang dapat memicu kemungkinan munculnya mutan resisten P.marneffei. Resistensi pada fungi dapat dipengaruhi beberapa faktor, salah satunya,overekspresi transporter pengeluaran obat (drug efflux transporter). Mekanismepompa pengeluaran obat diatur oleh berbagai transporter. Transporter yang palingumum diketahui ialah transporter ABC (ATP-binding-cassette) dan MFS (MajorFacilitator Superfamily). Transporter ABC multidrug (MDR) pada P. marneffeitelah dipelajari dengan baik, sedangkan transporter MFS MDR pada fungitersebut, belum mendapatkan perhatian yang sama. Penelitian ini fokus pada satutransporter MFS MDR P. marneffei, yakni PMAA 067100, yang diekspresikanpada Saccharomyces cerevisiae ADΔ; sistem ekspresi yang sangat rentan terhadapberbagai macam antifungi. Pengamatan melalui mikroskop konfokal dan uji DiskDiffusion menunjukkan bahwa transporter PMAA 067100 terlokalisasi padamembran sel S. cerevisiae ADΔ dan resisten terhadap Fluconazole danTerbinafine.;Penicillium marneffei has been known as a pathogenic fungi which isfound in Southeast Asia, especially Thailand. The infection by this fungirecognized as Penicilliosis, that caused systemic mycosis, might be lethal inimmunocompromised patient, specifically HIV/AIDS patient. Antifungal such asFluconazole and Ketoconazole, had been used against P. marneffei infection.However, the long-term-use of antifungal might cause an emerging resistant strainof P. marneffei. The resistance phenomenon in fungi is caused by several factors,one of it is the overexpression of drug efflux transporter. Mechanism of this effluxpump is regulated by some of transporters such as ABC (ATP-binding-cassette)and MFS (Major Facilitator Superfamily) transporter. The ABC multidrug (MDR)transporter of P. marneffei has been studied well, yet the underrated MFS MDRtransporter of the same fungi has not received the same attention. This study focuson one of P. marneffei MFS MDR transporter, known as PMAA 067100, whichwas expressed in Saccharomyces cerevisiae ADΔ; an expression system which isvery susceptible to many kind of antifungal. Observation through confocalmicroscope and Disk Diffusion test showed that PMAA 067100 transporter waslocalized in S. cerevisiae ADΔ cell membrane and resistant against Fluconazoleand Terbinafine., Penicillium marneffei has been known as a pathogenic fungi which isfound in Southeast Asia, especially Thailand. The infection by this fungirecognized as Penicilliosis, that caused systemic mycosis, might be lethal inimmunocompromised patient, specifically HIV/AIDS patient. Antifungal such asFluconazole and Ketoconazole, had been used against P. marneffei infection.However, the long-term-use of antifungal might cause an emerging resistant strainof P. marneffei. The resistance phenomenon in fungi is caused by several factors,one of it is the overexpression of drug efflux transporter. Mechanism of this effluxpump is regulated by some of transporters such as ABC (ATP-binding-cassette)and MFS (Major Facilitator Superfamily) transporter. The ABC multidrug (MDR)transporter of P. marneffei has been studied well, yet the underrated MFS MDRtransporter of the same fungi has not received the same attention. This study focuson one of P. marneffei MFS MDR transporter, known as PMAA 067100, whichwas expressed in Saccharomyces cerevisiae ADΔ; an expression system which isvery susceptible to many kind of antifungal. Observation through confocalmicroscope and Disk Diffusion test showed that PMAA 067100 transporter waslocalized in S. cerevisiae ADΔ cell membrane and resistant against Fluconazoleand Terbinafine.]"

"Filiariasis limfatik adalah suatu penyakit yang disebabkan oleh parasit Wuchereria bancrofti, Brugia malayi, dan Brugia timori. Diagnosis secara mikroskopis dengan menemukan mikrofilaria dalam darah mempunyai sensitifitas yang rendah terhadap penderita infeksi ringan, kronis, maupun pada occult filariasis. PCR merupakan metode invitro untuk mengamplifikasi DNA spesifik secara enzimatik. Disimpulkan bahwa teknik amplifikasi Hha 1 dengan PCR dapat digunakan sebagai alternatif dalam diagnosis filaria Brugia maupun deteksi larva filaria Brugia dalam nyamuk vektor untuk kepentingan epidemiologi."

"ABSTRAKInfeksi saluran pernafasan akut ISPA merupakan infeksi yang paling sering terjadi pada manusia dengan angka morbiditas dan mortalitas yang tinggi, terutama di negara-negara Asia Tenggara dan Afrika. Sudah diketahui bahwa sebagian besar ISPA disebabkan oleh virus, namun data mengenai etiologi virus di negara berkembang, terutama Indonesia masih terbatas. Studi ini menggunakan metode molekuler berupa PCR dan sekuensing untuk deteksi serta karakterisasi virus saluran nafas umum, termasuk virus zoonosis pada sampel swab orofaring. Subjek studi sebanyak 100 pasien anak dan dewasa dengan gejala infeksi saluran nafas yang datang ke RSU Tabanan. Dari 100 pasien didapatkan angka deteksi virus positif sebesar 40 dan angka ko-deteksi 7 . Pada anak-anak angka deteksi positif mencapai 46 28/61 , sedangkan pada dewasa sebesar 31 12/39 . Virus utama yang terdeteksi adalah influenza 15 , enterovirus 14 dan herpesvirus 11 . Subtipe virus yang mendominasi hasil deteksi yaitu H3N2, human rhinovirus A dan human betaherpesvirus 5. Sebagai kesimpulan, diantara pasien-pasien dengan ISPA di Tabanan, sebagian besar virus yang terdeteksi adalah virus influenza dengan subtipe H3N2.

---

ABSTRACT

Acute respiratory tract infection ARTI is the most common infection in human being. The morbidity and mortality rate is high, especially in Southeast Asia and Africa. While it is known that ARTIs are most commonly caused by virus, there are limited data about viral etiology of ARTI in developing countries, especially Indonesia. This study used molecular method to detect 10 common respiratory viral pathogens and zoonotic respiratory viruses. We collected oropharyngeal swabs from 100 patients in Tabanan Regency Hospital suspected with respiratory illness from all age groups. Among 100 patients tested, 40 tested positive for virus, with co detection rate 7 . In addition, positive detection rate in children was 46 28 61 and in adult 31 12 39 . Viruses that were most commonly detected include influenza 15 , enterovirus 14 and herpesvirus 11 . Among them, influenza virus subtype H3N2, human rhinovirus A and human betaherpesvirus 5 was the most frequently detected. In conclusion, among patients with ARTI in Tabanan Regency Hospital, influenza virus subtype H3N2 was the most predominant virus detected. "